首页>
外国专利>
In vitro diagnosis of cancer, based on detecting hypomethylation of deoxycytidine in CpG doublets present in specific sequences from the B melanoma antigen locus
In vitro diagnosis of cancer, based on detecting hypomethylation of deoxycytidine in CpG doublets present in specific sequences from the B melanoma antigen locus
In vitrodiagnosis of cancers, other than testicular tumors, in humans and animals by detecting a reduced level of methylation of deoxycytidine in specific sequences from the BAGE (B melanoma antigen) locus. In vitrodiagnosis of cancers, other than testicular tumors, in humans and animals comprises: (1) extracting total DNA from cells of a biological sample; (2) measuring methylation at position 5 of the pyrimidine ring in deoxycytidine (dC) residues in 5'-CpG-3' doublets in specific sequences (A) from the BAGE locus; (3) comparing the level of methylation with that determined in a similar DNA extract from non-cancerous tissue; and (4) correlating a lower level of methylation in the test sample with diagnosis of cancer. (A) is any of: (a) 13 sequences reproduced (of 1273 to 243 nucleotides); (b) fragments of (a) containing at least one CpG, or (c) derivatives of (a) and (b) with at least 90% homology, containing at least one CpG and able to hybridize to (a) or (b), particularly in 5 X SSPE buffer at 55 [deg]C. Independent claims are also included for: (1) the 13 specified sequences (A) and their fragments containing at least one CpG; (2) primers pairs (14)/(15) and (16)/(17) for amplification of (A) or their fragments; and (3) kit for the new process comprising at least one primer pair of (2); reagents for performing PCR; sodium bisulfite; restriction enzymes such as MboI, AclI or HphI; methylation reagent such as M.SssI and a standard curve corresponding to 0-100% methylation of at least one (A), depending on the primer pair used. tttagaggattaggagaagggggagt (14) acctaccaattaacattattactaacatta (15) gatggtggtggtaatagagatggt (16) ccttaaacaatataaaccctaataa (17).
展开▼
